What type of bond links amino acids into a protein chain
peptide bond
What are the three components of a nucleotide?
Sugar, phosphate group,
... [Show More] nitrogenous base
What will determine whether a particular chain of amino acids is hydrophobic or hydrophilic?
The R-groups in that part of the peptide
If a hydrophilic signal like insulin is intended to pass its signal to the nucleus inside a cell it will pass through the membrane to get to the DNA
false
When a cell divides and the daughter cell changes (so for instance the inner cell mass divides and some start to differentiate as part of the future reproductive system) the DNA gets changed
false
What does a kinase do?
Adds a phosphate to another protein
In the absence of cyclin, CDK
Does not bind target proteins or phosphorylate anything
What happens to G1/S cyclin before S phase
It's ubiquitinated
How might a ubiquitin inhibitor affect the cell cycle?
Proteins inappropriate for the given phase might continue to be phosphorylated
What does cdk do directly during S phase?
Phosphorylates proteins leading to DNA replication
Why is bi-orientation - each sister chromatid attached to a different centrosome so important?
It ensures that each cell gets a sister chromatid
You have a template strand of DNA that reads:
5' -ATCGTCGGCC -3'
Pick the correct mRNA that would be transcribed from this template strand DNA
5' - GGCCGACGAU - 3'
If the coding strand of DNA has the sequence
5′-CGAGACTTCTGA-3′, what will the sequence of the transcribed mRNA be?
5′-CGAGACUUCUGA-3′
If a particular DNA sequence has a cytosine content of 25%, what is its adenine content?
25%
There are 61 mRNA codons that specify an amino acid, but only 45 tRNAs. This is best explained by the fact that
the rules for base pairing between the third base of a codon and tRNA are flexible.
What would be the effect if the A had been deleted instead of changed?
5' CUGACUCCUGAGGAGAAGTCT 3' to
5' CUGACUCCUGGGAGAAGUCU 3'
the protein wouldn't work There would be a frameshift mutation
Rank the types of control in terms of speed of response (1 is fastest):
1 Post-translational, 2 translational, 3 transcriptional
Which of the following does not happen in prokaryotes, but does in eukaryotes?
Chromatin remodeling
The restrictive temperature for a temperature sensitive mutant is the temperature when
It can no longer grow, survive or flourish
From the reading (a week ago, but still from the reading). A reaction is considered to be spontaneous when
Its ΔG < 0
What way could a cell drive an endergonic reaction?
Couple it to the hydrolysis of ATP --> ADP + Pi
An enzyme can change an endergonic reaction to an exergonic one
false
How many aqueous compartments are there in the chloroplast?
3
Can Glycolysis proceed in the absence of Oxygen (O2)?
yes
What is the net "yield" of glycolysis in ATP per glucose molecule?
2 ATP per glucose
Which of the following statements about NAD+ is true?
NAD+ is reduced to NADH during glycolysis
What is the GROSS "yield" of glycolysis in ATP per glucose molecule?
4 ATP per glucose
The O2 you breathe in is used to produce the CO2 you breathe out.
false [Show Less]