What is translocation is associated with Burkitt's Lymphoma?
a. t(18; 14)
b. t(9; 22)
c. t(8; 14)
d. t(15; 17)
t(8; 14)
TIP: Burkkitt's 8
... [Show More] letters,
Locus PF Child Paternity Index
LOC-A1 3 2/3 2.18
LOC-B2 7/5 5 0.798
LOC-C3 17/17 9/17 5.21
LOC-D4 12 12 1.37
Based on the data presented in the table above and with a prior probability (PP) of 0.5, the probability of paternity in this case is :
a. 92.5%
b. 99.5%
c. 90.5 &
d. 95.5%
92.5 %
Multiply all PI together = CPI
(CPI x PP) / [CPI x P + (1 - PP)
OR ...
CPI / (1 + CPI)
00:02
01:33
You have sequenced a gene and observe the following:
Reference: atgctggcacgacaggtttcccgactgg
Sequenced: atgCctggcacgacaggtttcccgactgg
The mutation observed is a:
a. Frame-shift mutation
b. Insertion
c. Silent mutation
d. Non-conservative mutation
Frame-shift mutation
Which of the following is not involved in the splicing reaction?
a. 5' splice site
b. Hairpin loops
c. Branch A point
d. 3' splice site
Hairpin loops
Which of the following statements are characteristics of the melt curve analysis? (hint: more than one answer)
a. At the melting point, the probe separates from the target strand and fluorescence rapidly decreases.
b. The melting temperature of double stranded DNA depends on its base composition and length.
c. All PCR products for a specific primer pair should have the same melting temperature.
d. When hybridization probes are utilized, the temperature is incrementally decreased while fluorescence is monitored.
At the melting point, the probe separates from the target strand and fluorescence rapidly decreases.
The melting temperature of double stranded DNA depends on its base composition and length.
All PCR products for a specific primer pair should have the same melting temperature.
In the field of molecular diagnostics, which one of the following genes is responsible for the synthesis of DNA, promote cell division, and inhibit cell death?
a. Proto-oncogenes
b. Tumor suppressor genes
c. Oncogenes
d. Mitochondrial genes
Proto-oncogenes
Microsatellite instability is best described as:
a. The ability of a gene with repeating elements of 8-10 base pairs to randomly mutate
b. Contraction or expansion of the genome caused by frameshift mutations (deletions or insertions) in elements of the genome consisting of a repeating sequence of 1-3 base pairs
c. Repetitive elements in the genome with the ability to self-prime, thus creating additional copies of genetic material at the allele loci
d. Random gene rearrangement between repeating elements of the same size on different chromosomes resulting in different size gene products
Contraction or expansion of the genome caused by frameshift mutations (deletions or insertions) in elements of the genome consisting of a repeating sequence of 1-3 base pairs
Purines and pyrimidines differ from each other in that:
a. Purines are found RNA; pyrimidines are found in DNA
b. There's no difference between purines and pyrimidines
c. Pyrimidines have two rings; purines have one ring
d. Purines have two rings; pyrimidines have one ring
Purines have two rings; pyrimidines have one ring
TIP: Reciprocals of each other.
Purine, shorter word, longer rings.
Pyrimidine, longer word, shorter ring.
Which of the following molecular methodologies would be the best for detecting a trinucleotide repeat disorder such as Huntington's disease?
a. Heteroduplex analysis
b. Variable number tandem repeat analysis
c. Single strand conformation polymorphism analysis
d. Reverse-Transcriptase PCR
Variable number tandem repeat analysis
Locus Test C M PF1 PF2
A1 12/15 12 15/17 12/15
B2 13 13/13 13/15 14/15
C3 7/8 8 7 7/7
D4 9/11 9/9 10/11 11
E5 6 6/6 5/7 6
Based on the results above, which one of the two possible fathers is the two-month old's biological father?
a. Possible Father 1
b. Possible Father 2
c. Neither of the Possible Fathers
Neither
Sickle cell disease is an autosomal genetic disease due to a point mutation in the beta-globin gene, where glutamic acid is substituted for valine at the sixth codon of the gene, resulting in a faulty hemoglobin S (Hb S). Sickle cell disease is one of many genetic diseases where a single gene controls the expression of many phenotypic traits. The phenomenon where a single gene controls the expression of many phenotypic traits is best referred to as:
a. Pleiotrophy
b. Polygenic inheritance
c. Epistasis
d. Epigenetics
Pleiotrophy
A technologist uses the spectrophotometer to quantify the amount of DNA extracted from a blood specimen diluted 1:30. The absorbance reading at 260 nm was found to be 2.545. If the absorbance at 280 nm gave a reading of 1.406, and if the the DNA extract was re-suspended in 0.800 mL of EDTA solution, the DNA yield is:
a. 3540 micrograms
b. 3450 micrograms
c. 3504 micrograms
d. 3054 micrograms
3054 ug
260 reading x 50 ug/ml (DNA) x dilution factor x resupsension = DNA Yield
260 x 50 x 30 x 0.8 = 3054
00:02
01:33
When sequencing HLA-DR what is targeted?
a. Exon 1 of the α subunit
b. Exon 2 of the α subunit
c. Exon 1 of the β subunit
d. Exon 2 of the β subunit
Exon 2 of the β subunit
All of the following are components of nucleic acids, EXCEPT:
a. Phosphate group
b. Sugar (ribose or deoxyribose)
c. Nitrogenous base (A, G, C, T)
d. Formamide
Formamide
This polymerase acts on DNA and produces Transfer RNA:
a. RNA Pol II
b. DNA Pol II
c. RNA Pol III
d. DNA Pol III
RNA pol III
In mantle cell lymphoma (MCL), this is the fusion gene created:
a. EWS-FLI1
b. CCND1-IGH
c. BCR-IGH
d. c-myc-EWS
CCND1-IGH
(Cyclin D1)
This enzyme is known for "unzipping" genes:
a. Alkaline Phosphatase
b. RNA polymerase
c. Apyrase
d. Helicase
Helicase
What translocation results in synovial sarcoma, a muscle and fibrous tissue cancer?
a. t(18;X)
b. t(15;17)
c. t(8;X)
d. t(9;12)
t(18;X)
Which of the following reagents will successfully decontaminate a bench top that has been exposed to DNA amplification products?
a. 70% Ethanol
b. 5% Bleach
c. 100% Isopropanol
d. 10% Methanol
5% Bleach
As a technologist working in a small clinical laboratory, a nasal swab specimen, suspected to be colonized by a variety of upper respiratory viruses, came to your laboratory. You are tasked with determining whether the specimen is colonized with rhinovirus, coronavirus, and influenza. Which PCR method would best be suitable for this task?
a. Nested PCR
b. Real-time PCR
c. NASBA
d. Multiplex PCR
Multiplex PCR
According to Chargaff's rule of base pairing, adenine pairs with:
a. Cytosine
b. Threonine
c. Thymine
d. Thymidine
Tymine
The t(11;22) translocation is responsible for:
a. Follicular lymphoma
b. Papillary thyroid cancer
c. Synovial sarcoma
d. Ewing sarcoma
Ewing sarcoma
TIP: Affects children and adults between the ages of 11 - 22
Replication forks, known as origins of DNA replication, are created by this enzyme:
a. Ligase
b. Taq Polymerase
c. Primase
d. Helicase
Helicase
What enzyme is involved in LCR?
a. Taq polymerase
b. RNA polymerase
c. DNA Ligase
d. Luciferase
DNA Ligase
A technologist uses the spectrophotometer to quantify the amount of DNA extracted from a blood specimen diluted 1:30. The absorbance reading at 260 nm was found to be 2.545. The concentration of DNA in this extract is:
a. 76.35 micrograms/mL
b. 3817.5 micrograms/mL
c. 381.75 micrograms/mL
d. 3054.0 micrograms/mL
3817.5 ug/ml
260 nm x 50 ng/ul (DNA) x 30 (dilution factor) = conc. DNA
If two parents are heterozygous for an autosomal recessive disease, then their offspring will most likely follow this gene frequency pattern:
a. 25% homozygous dominant, 50% heterozygous, and 25% homozygous recessive
b. 50% homozygous dominant, and 50% homozygous recessive
c. 100% homozygous for the dominant phenotype
d. 100% homozygous for the recessive phenotype
Aa x Aa
1 AA : 2 Aa : 1 aa
25% : 50% : 25%
Which of the following is not a characteristic of eukaryotic DNA transcription?
a. Multiple RNA polymerases
b. TATA-binding protein
c. Strict promoter sequences
d. Transcription factors
Strict promoter sequences
If a woman is infected with the HPV virus, which of the following parameters increases her risk of developing cervical cancer?
a. A vegetarian diet
b. Never having been pregnant
c. Obesity
d. Smoking
Smoking
All of the following methods of amplification are considered target amplification, except:
a. Quantitative PCR
b. NASBA
c. Strand Displacement Amplification
d. Reverse Transcriptase PCR
NASBA
Transcription-based amp. system (TAS)
The mother of a 3 year old boy took him to the doctor's office for concerns of an underlying genetic condition. A karyotype order was sent to the Molecular Diagnostic lab. Karyotype results show 47, XY,+21. Based on these results, the boy has:
a. Patau Syndrome
b. Down Syndrome
c. Edward Syndrome
d. Cri du chat Syndrome
Down syndrome
Which of the following is not a mutation found in the HFE gene of hemochromatosis?
a. C282Y
b. H63D
c. 5382insC
d. S65C
5382insC
TIP: in C's bra --> breast cancer --> BRAC1
The enzyme that primes DNA synthesis is:
a. DNA polymerase
b. Exonuclease
c. DNA ligase
d. DNA primase
DNA primase
What does barcoding do in Next Generation Sequencing?
a. Adds a unique tag to each of the wells/flow cells/chips
b. Adds a unique tag to all nucleic acids within one sample so that various samples can be mixed
c. Binds sample nucleic acids to a chip in a specific pattern
d. Adds various fluorophores to your sample nucleic acids
Adds a unique tag to all nucleic acids within one sample so that various samples can be mixed
Locus PF Child PI
LOC-A1 3 2/3 2.18
LOC-B2 7/5 5 0.798
LOC-C3 15/17 9/17 5.21
LOC-D4 12 12 1.37
Based on the data presented in the table, what is the combined paternity index, CPI, from the loci tested: LOC-A1, LOC-B2, LOC-C3 and LOC-D4?
a. 12.42
b. 9.558
c. 15.56
d. 2.38
12.42
CPI = multiply all PI
Nucleic acid hybridization methods can be affected by a host of factors. Select all the factors that that can influence this process.
a. G:C ratio of bases
b. pH of the hybridization reaction
c. Hybridization temperature
d. All of the above
All of the above
Mutation in this gene (Xp21) is associated with Duchenne Muscular Dystrophy:
a. Dystrophin
b. P53
c. Musculin
d. C-myc
Dystrophin
A DNA specimen was sent to your Molecular Diagnostics Laboratory for DNA sequencing, in order to determine whether patient A has a particular mutation in gene X. The gene sequence is known. However, the gene mutation itself is not known. Therefore, DNA sequencing cannot be performed on this DNA specimen. (True or False)
a. True
b. False
True
You can't find something you don't know the sequence of. [Show Less]