HLA CHT Practice Exam 47 Questions with Verified Answers
Blood specimens known to carry pathogens are packaged the same as routine specimens.....
... [Show More] true or false - CORRECT ANSWER True
When performing a blood draw, what is not part of the routine procedure?
Change gloves in between patients
Informing patient of HIV status
Wear a lab coat or gown - CORRECT ANSWER Informing patient of HIV status
What is a fire assembly area? - CORRECT ANSWER A safe place to meet during a fire, that is predetermined by employer
Reagent x arrives in the lab, What action is the best action to do? - CORRECT ANSWER Periodically QC the reagent and develop a QA analysis of its performance to derive an appropriate expiration date
You have a patient that does not want to be listed. What should you do with all of the reports, typing, paperwork etc? Some is online (LIS) and others are on paper. - CORRECT ANSWER Keep said paperwork for two years as long as the LIS is backed up regularly and paper storage is secure
A 100ul stock solution of DNA is 160 ug/ml. What final volume should you dilute the stock, to achieve a working concentration of 40ug/ml? - CORRECT ANSWER 400ul You would use the formula C1V1=C2V2
100x160= 1600 1600/40=400 C
Solution three combines all of solution one and two. Solution one consists of 2.0ml of cells at a concentration 5x10 to the 6th, Solution two consists of 7.0ml of cells at a concentration of 3x10 to the 6th. What is the cell concentration of solution 3. - CORRECT ANSWER 3.4 x 10 to the 6th cells/ml
2.0x5=10
7.0x3=21
31cells/ml divided by total volume of solution one and two so 9mls=3.4cells/ml
What is equivalent to 2N H2SO4? The molecular weight of H2SO4 is 98g/mol - CORRECT ANSWER 9.8g H2SO4 om 100ml of H2O
100g of NaCl (NA=22.99g/mol Cl=35.43g/mol) is dissolved in 1500ml of water, what is the molarity? - CORRECT ANSWER 1.14m
Approximately ho many grams of sodium chloride are required per 100ml of water? - CORRECT ANSWER 0.85
Would you be able to use blood that was collected in EDTA for serology? - CORRECT ANSWER No
What organ yields the most B cells? - CORRECT ANSWER Spleen
How should whole blood specimens drawn into ACD tubes be stored? - CORRECT ANSWER Room temperature
The absolute A260 and A280 values and their ratio for a DNA sample provide what information?
a. Length and concentration
b. Free 3' ends and length
c. Concentration and RNA/Protein contamination
d. Concentration and percent degraded - CORRECT ANSWER Concentration and RNA/Protein contamination
Which of the following samples can be used for determining a patients class I HLA type with a DNA based method?
A. 5ml ficoll separated PBLs in PBS
B. 2ml peripheral blood in EDTA
C. 3ml B cells in PBS, isolated by negative selection magnetic beads
D A and B
E All of the above - CORRECT ANSWER E
Which of the folllowing samples would be least preferred for CDC/PRA testing?
A Plain red top tube
B Serum separator tube
C Frozen serum
D ACD yellow top tube - CORRECT ANSWER D
Thrombin is used for what? - CORRECT ANSWER Clotting anti-coagulated plasma
What treatment causes the chelation of magnesium and calcium? - CORRECT ANSWER EDTA
What is the purpose of pronasing cells for a flow crossmatch? - CORRECT ANSWER To remove CD20 from the cell surface
What does C1V1=C2V2 mean? - CORRECT ANSWER C1=Concentration of the stock
V1=volume to be removed from the concentrated stock solution
C2=Final concentration of the diluted solution
V2=Final volume of the diluted solution
Dead cells stained with AO/EB appear orange because
a. Ethidium bromide prevents AO binding
b. AO leaks out of the dead cell, leaving only ethidium bromide
c. Ethidium bromide fluoresces much more strongly than AO
d. AO binds only RNA, which washes away when the cell is dead
e. Dead cells are actually orange. - CORRECT ANSWER C
Ficoll separates lymphocytes based on what? - CORRECT ANSWER Density
What effect do heterophile antibodies in the complement have on the AHG-CDC assay?
A) CDC assay complement does not contain appreciable amounts of heterophile antibodies
B) Enhances the effectiveness of the complement
C) many false negative reactions
D) Decreased CYNAP effect - CORRECT ANSWER C
What is the usual source of complement used in CDC crossmatch assay? - CORRECT ANSWER Rabbit
Which of the following is true about storing flourescent reagents including monoclonal antibodies and micro array beads?
A) Ensure reagent is kept frozen as much as possible, so replace vial in freezer between runs
B) Ensure reagent is kept in the dark to avoid photobleaching, so use light blocking vials and store them in a closed box
C) Ensure reagent is not frozen, so leave vials at 4c or on the beach
D) Ensure reagent receives sufficient light to activate fluorescence, so leave vial on the counter with the lights for at least 1 hour - CORRECT ANSWER B
The usual final concentration of DMSO for freezing cells? - CORRECT ANSWER 10 percent
A short DNA oligonucleotide used for PCR-SSP amplification is what?
A) Probe
B) Amplicon
C) Polymerase
D) Primer
E) Okazaki fragment - CORRECT ANSWER Primer
Which of the listed probes with have the highest TM?
A) AACTAGTTA
B) CTATGGATCGTTGGCTACTCT
C) GTAGATTATATTACTCTAGCA
D) AACTAGTTC
E) ATATATATAT - CORRECT ANSWER C...Look for the most G/Cs
Primers and probes bind to their DNA targets through a process known as
a) High stringency
b) Hydrogen bonding
c) Covalent bonding
d) Primer dimerism
e) Low Stringency - CORRECT ANSWER B Hydrogen Bonding
Which is true of the 3' and/or 5' ends of an oligonucleotide primer?
a) The 3' and 5' ends always have purines
b) The 3' and 5' ends always have pyrimidines
c) The 3' and 5' ends may both serve as an template for Taq elongation
d) The 3' end may accept GTP in the presence of a DNA polymerase
e) The 5' end is the critical portion for determining the specificity of a primer - CORRECT ANSWER E The 5' is the critical portion for determining the specificity of a primer
What is true of the DNA polymerase used in PCR?
A) The enzyme should only incorporate dideoxy nucleotides
B) The enzyme should have a low fidelity
C) The enzyme should denature at 37f
D) The enzyme should be heat resistant - CORRECT ANSWER D Heat resistant
The structural component of a nucleotide is what?
A) A, G, C, U, T
B) A, C, G, U
C) Base, Sugar, Phosphate
D) Base, Acid, Neutral - CORRECT ANSWER C....Base, Sugar, Phosphate
What is true regarding dUTP?
A) Nucleotide in unamplified DNA
B) Similar to dCTP in base pairing
C) RNA Sugar
D) dUTP can be substituted for dTTP in PCR - CORRECT ANSWER D.....dUTP can be substituted for dTTP in PCR
Why should you not store enzyme reagents in a frost free freezer?
A) Frost free freezers are not cold enough
B) Frost freezers have temperature fluctuations during defrost cycles
C) Humidity in frost freezers is too low - CORRECT ANSWER B...Frost freezers have temperature fluctuations during defrost cycles
Where should SSO probes be designed to have their target mismatches in order to maximize specificity? - CORRECT ANSWER In the center of the probe
Tris-EDTA buffer, pH 8 is the reccomended buffer for long term storage of DNA, especially at 4c. How does it work?
A) The high pH inhibits bacterial growth while the EDTA inhibits nucleases
B) The high pH inhibits nucleases while the EDTA inhibits bacterial growth
C) The high pH inhibits acid hydrolysis while the EDTA inhibits nucleases - CORRECT ANSWER C....The High pH inhibits acid hydrolysis while the EDTA inhibits nucleases
If your lab receives a sample with an unknown B locus allele, what techniques would be able to detect it?
A) PCR-SSP
B) PCR-SSOP
C) Sequencing - CORRECT ANSWER C.....Sequencing
Which statement is true about the amplification of DNA by the polymerase chain reaction?
A) PCR does not require the two strands of DNA to be denatured
B) PCR requires an enzyme that cuts the DNA at specific nucleotide sequences
C) PCR requires two primers to initiate DNA synthesis - CORRECT ANSWER C.....PCR requires two primers to initiate DNA synthesis
Your lab receives a sample with a potential novel allele, what technique should you use for submission to the HLA reference database?
A)Serology
B) DNA sequencing
C) SSP
D) SSOP - CORRECT ANSWER B.....DNA Sequencing
Which statement is true of agarose gel electrophoresis of PCR-SSP products?
A) Short DNA fragments move slower than large fragments
B) DNA migrates toward the positive electrode
C) a higher percent agarose gel improves the resolution of large fragments - CORRECT ANSWER B.... DNA migrates toward the positive electrode
SSP and SSOP reagents commonly target specific regions of the HLA Class I genes, the regions are what?
A) Introns
B) Conserved Regions
C) Polymorphic Regions
D) Promoter Regions - CORRECT ANSWER C....Polymorphic Regions
Which Acronym is wrong?
A) ASHI- American Society for Histocompatibility and Immunogenetics
B) PCR- Polymerase Chain Reaction
C) CLIA- Clinical Laboratory Improvement Amendments
D) NGS- Next Genomic Sequence - CORRECT ANSWER D......Next Genomic Sequence is supposed to be Next Generation Sequence
What Probe would hybridize under stringent conditions to the following sequence-5' AGTTCGATGC?
A) 5' GCATCGAACT
B) 3' AGTTCGATGC
C) 3' GCATCGAACT
D) 5' AGTTCGATGC - CORRECT ANSWER A.... GCATCGAACT
Which of the ABOs are compatible?
A) A into O
B) O into A
C) B into AB
D) AB into B
E) A into B
1) A only
2) B and D
3) E
4) B and C - CORRECT ANSWER B and C........O into A and B into AB
How does ABO-A2 differ from ABO-A1? - CORRECT ANSWER The A2 phenotype expresses about 1/4 of the A antigen sites as A1
What activities should be performed in the post PCR area?
A) DNA extraction, low stringency wash, probing
B) Amplification, probing, high stringency washes
C) Gel electrophoresis, probing, primer aliquoting
D) DNA extraction, high stringency wash, primer synthesis - CORRECT ANSWER B......Amplification, probing, high stringency washes
How many thermal cycles are in a PCR program for HLA molecular typing?
A) 30 Cycles
B)5 Cycles
C) 15 Cycles
D) 35 Cycles - CORRECT ANSWER A...30 cycles [Show Less]