In snapdragons, heterozygotes have pink flowers whereas homozygous dominant have red flowers and homozygous recessive have white flowers. When plants with
... [Show More] red flowers are crossed with plants with white flowers, how many of the offspring will have red flowers?
a. zero
a woman with type "A" blood and a man with type "B" blood have a daughter with blood type "O" and a son with blood type "B". Which of the following represents the son's genotype?
c. I^Bi
the coding region of a piece of mRNA consists of 300 nucleotide bases. How many amino acids will this region likely code for?
b. 100
A plant with red flowers is crossed with a plant with white flowers. The offspring have pink flowers. What is this an example of?
incomplete dominance
Connects the Okazaki fragments formed on the lagging strand of DNA thereby creating a complete and seamless piece of DNA.
DNA ligase
Which of these statements is false regarding point mutations?
a. they involve changes in just a single base pair.
b. they always cause drastic changes in protein structure
c. they may produce a change in the amino acid sequence of a protein
d. they may cause the formation of a "stop" codon
b. they always cause a drastic changes in protein structure
What amino acid sequence will be generated from the following DNA sequence? 3' ATATTAACCCTAACTCCACTCCA 5'
d. met-gly-leu-arg
The pedigree below traces the inheritance of alkaptonuria, a biochemical disorder in humans. Affected individuals are indicated by filled-in circles (females) and squares (males). This disease state appears to be caused by a _______ allele.
recessive
Where and why are Okazaki fragments synthesized?
d. on the lagging stand, since DNA polymerase adds bases only in the 5' to 3' direction of newly synthesized DNA.
Tay-Sachs disease causes nerve cells to malfunction and results in death by age 4. Two healthy parents know from blood tests that each parent carries a recessive allele responsible for Tay-Sachs. If their first three children have the disease, what is the probability that their fourth child will have the disease?
b. 1/4 (or 25%)
The diagram above shows two normal chromosomes in a cell. Letters represent major segments of the chromosomes (perhaps think of the letters as genes). What is illustrated in the two chromosomes below (as compared to the two original chromosomes above)?
c. translocation
John is homozygous recessive for the earlobe gene and has attached earlobes. Marcia is heterozygous for the earlobe gene and has free earlobes. If John and Marcia mate and have 8 children, what phenotypes (and in what ratios) would be predicted in their children?
e. 4 kids would have free earlobes and 4 kids would have attached earlobes
Which of the following best describes the role of tRNA during gene expression?
a. tRNA carries specific amino acids to ribosomes during translocation
If an organism with the genotype AaBb produces gametes, what proportion of the gametes would be AB? Assume the genes are not linked.
b. 1/4
What is the function of primase?
c. synthesize a short RNA strand that is used as a primer for DNA synthesis
Consider the Meselson-Stahl experiment illustrated below. Which of the banding patterns shown below represents the correct predicted banding pattern for Generation 1 of the SEMICONSERVATIVE replication model?
b. B
Which of the following describes the cell below?
c. it is diploid and is heterozygous for two genes
The image below represents the lac operon. Under what conditions would the lac Z,Y and A genes be expressed?
e. when lactose is present
what is the role of the "operator" in the lac operon?
c. to bind with the repressor protein and shut down expression of the lac genes when lactose is absent
Below is a description of various mutations that were used to figure out how the lac operon works. use the above information and your understanding of the lactose system to predict lac z and lac Y expression for the genotype below.
B
In snapdragons, heteroztgotes have pink flowers whereas homozygous dominant have red flowers and homozygous recessive have white flowers. If two heterozygotes are crossed with each other, what percent of the offspring will likely have pink flowers?
a. 50%
John is homozygous recessive for the earlobe gene and has attached earlobes. Marcia is heterozygous for the earlobe gene and has free earlobes. If John and Marica mate and have 16 children, what phenotypes (and in what ratios) would be predicted in their children?
e. 8 kids would have free earlobes and 8 would have attached earlobes. [Show Less]